Skip to main content

Crystal structure of Fis bound to 27 bp sequence DNA F28 (AAATTTGTTTGAGCGTTGAGCAAATTT)


Changes made to a PDB entry after its initial release are considered to be either “major” or “minor”. The latest minor version of each major version is available as a file download. More information about the PDB versioning is available.


Version NumberVersion DateVersion Type/Reason Version ChangeRevised CIF Category
1.02013-05-01Initial release
1.12013-05-22Database references
1.22013-07-31Database references
1.32023-09-20Data collection, Database references, Refinement descriptionchem_comp_atom, chem_comp_bond, database_2, pdbx_initial_refinement_model Download