☰ Navigation Tabs
Crystal structure of Fis bound to 27 bp sequence DNA F28 (AAATTTGTTTGAGCGTTGAGCAAATTT)
Starting Model(s) Initial Refinement Model(s) Type Source Accession Code Details experimental model PDB 3IV5 PDB ENTRY 3IV5
Crystallization Crystalization Experiments ID Method pH Temperature Details 1 VAPOR DIFFUSION, HANGING DROP 8.5 277 0.2 M sodium citrate, 0.1 M Tris-HCl, pH 8.5, 36% PEG400, VAPOR DIFFUSION, HANGING DROP, temperature 277K
Crystal Properties Matthews coefficient Solvent content 3.77 67.38
Crystal Data Unit Cell Length ( Å ) Angle ( ˚ ) a = 42.79 α = 90 b = 89.39 β = 90 c = 154.15 γ = 90
Symmetry Space Group P 21 21 21
Diffraction Diffraction Experiment ID # Crystal ID Scattering Type Data Collection Temperature Detector Detector Type Details Collection Date Monochromator Protocol 1 1 x-ray 100 CCD ADSC QUANTUM 315 2011-07-24 M SINGLE WAVELENGTH
Radiation Source ID # Source Type Wavelength List Synchrotron Site Beamline 1 SYNCHROTRON APS BEAMLINE 24-ID-C 0.92017 APS 24-ID-C
Data Collection Overall ID # Resolution (High) Resolution (Low) Percent Possible (Observed) R Merge I (Observed) Net I Over Average Sigma (I) Redundancy Number Reflections (All) Number Reflections (Observed) Observed Criterion Sigma (F) Observed Criterion Sigma (I) B (Isotropic) From Wilson Plot 1 2.716 100 99.6 0.082 16.06 6.99 16603 -3 63.279
Highest Resolution Shell ID # Resolution (High) Resolution (Low) Percent Possible (All) Percent Possible (Observed) R Merge I (Observed) Mean I Over Sigma (Observed) Redundancy Number Unique Reflections (All) 1 2.716 2.79 97.5 0.88 2.38
Refinement Statistics Diffraction ID Structure Solution Method Cross Validation method Starting model Resolution (High) Resolution (Low) Cut-off Sigma (F) Number Reflections (Observed) Number Reflections (R-Free) Percent Reflections (Observed) R-Factor (Observed) R-Work (Depositor) R-Work (DCC) R-Free (Depositor) R-Free (DCC) R-Free Selection Details Mean Isotropic B X-RAY DIFFRACTION MOLECULAR REPLACEMENT THROUGHOUT PDB ENTRY 3IV5 2.716 42.927 2 16577 1659 99.48 0.221 0.2169 0.2221 0.2575 0.2607 RANDOM 38.3474
Temperature Factor Modeling Anisotropic B[1][1] Anisotropic B[1][2] Anisotropic B[1][3] Anisotropic B[2][2] Anisotropic B[2][3] Anisotropic B[3][3]
RMS Deviations Key Refinement Restraint Deviation f_dihedral_angle_d 26.336 f_angle_d 1.491 f_chiral_restr 0.075 f_bond_d 0.008 f_plane_restr 0.004
Non-Hydrogen Atoms Used in Refinement Non-Hydrogen Atoms Number Protein Atoms 1505 Nucleic Acid Atoms 1101 Solvent Atoms 5 Heterogen Atoms
Software Software Software Name Purpose XSCALE data scaling PHASER phasing PHENIX refinement PDB_EXTRACT data extraction XDS data reduction