5E3N

Crystal structure of Fis bound to 27bp DNA F31 (AAATTTGTAGGAATTTTCTGCAAATTT)


Experimental Data Snapshot

  • Method: X-RAY DIFFRACTION
  • Resolution: 2.66 Å
  • R-Value Free: 0.252 
  • R-Value Work: 0.217 
  • R-Value Observed: 0.218 

wwPDB Validation   3D Report Full Report


This is version 1.3 of the entry. See complete history


Literature

DNA Sequence Determinants Controlling Affinity, Stability and Shape of DNA Complexes Bound by the Nucleoid Protein Fis.

Hancock, S.P.Stella, S.Cascio, D.Johnson, R.C.

(2016) PLoS One 11: e0150189-e0150189

  • DOI: https://doi.org/10.1371/journal.pone.0150189
  • Primary Citation of Related Structures:  
    5DS9, 5DTD, 5E3L, 5E3M, 5E3N, 5E3O

  • PubMed Abstract: 

    The abundant Fis nucleoid protein selectively binds poorly related DNA sequences with high affinities to regulate diverse DNA reactions. Fis binds DNA primarily through DNA backbone contacts and selects target sites by reading conformational properties of DNA sequences, most prominently intrinsic minor groove widths. High-affinity binding requires Fis-stabilized DNA conformational changes that vary depending on DNA sequence. In order to better understand the molecular basis for high affinity site recognition, we analyzed the effects of DNA sequence within and flanking the core Fis binding site on binding affinity and DNA structure. X-ray crystal structures of Fis-DNA complexes containing variable sequences in the noncontacted center of the binding site or variations within the major groove interfaces show that the DNA can adapt to the Fis dimer surface asymmetrically. We show that the presence and position of pyrimidine-purine base steps within the major groove interfaces affect both local DNA bending and minor groove compression to modulate affinities and lifetimes of Fis-DNA complexes. Sequences flanking the core binding site also modulate complex affinities, lifetimes, and the degree of local and global Fis-induced DNA bending. In particular, a G immediately upstream of the 15 bp core sequence inhibits binding and bending, and A-tracts within the flanking base pairs increase both complex lifetimes and global DNA curvatures. Taken together, our observations support a revised DNA motif specifying high-affinity Fis binding and highlight the range of conformations that Fis-bound DNA can adopt. The affinities and DNA conformations of individual Fis-DNA complexes are likely to be tailored to their context-specific biological functions.


  • Organizational Affiliation

    Department of Biological Chemistry, David Geffen School of Medicine at the University of California at Los Angeles, Los Angeles, California, United States of America.


Macromolecules

Find similar proteins by:  (by identity cutoff)  |  3D Structure
Entity ID: 1
MoleculeChains Sequence LengthOrganismDetailsImage
DNA-binding protein Fis
A, B
98Escherichia coli K-12Mutation(s): 0 
Gene Names: fisb3261JW3229
UniProt
Find proteins for P0A6R3 (Escherichia coli (strain K12))
Explore P0A6R3 
Go to UniProtKB:  P0A6R3
Entity Groups  
Sequence Clusters30% Identity50% Identity70% Identity90% Identity95% Identity100% Identity
UniProt GroupP0A6R3
Sequence Annotations
Expand
  • Reference Sequence
Find similar nucleic acids by:  (by identity cutoff)  |  3D Structure
Entity ID: 2
MoleculeChains LengthOrganismImage
DNA (27-MER)27synthetic construct
Sequence Annotations
Expand
  • Reference Sequence
Find similar nucleic acids by:  (by identity cutoff)  |  3D Structure
Entity ID: 3
MoleculeChains LengthOrganismImage
DNA (27-MER)27synthetic construct
Sequence Annotations
Expand
  • Reference Sequence
Experimental Data & Validation

Experimental Data

  • Method: X-RAY DIFFRACTION
  • Resolution: 2.66 Å
  • R-Value Free: 0.252 
  • R-Value Work: 0.217 
  • R-Value Observed: 0.218 
  • Space Group: P 21 21 21
Unit Cell:
Length ( Å )Angle ( ˚ )
a = 43.19α = 90
b = 92.98β = 90
c = 153.94γ = 90
Software Package:
Software NamePurpose
Aimlessdata scaling
PHASERphasing
PHENIXrefinement
PDB_EXTRACTdata extraction

Structure Validation

View Full Validation Report



Entry History & Funding Information

Deposition Data


Funding OrganizationLocationGrant Number
National Institutes of Health/National Institute of General Medical Sciences (NIH/NIGMS)United StatesGM038509

Revision History  (Full details and data files)

  • Version 1.0: 2016-03-09
    Type: Initial release
  • Version 1.1: 2016-03-23
    Changes: Database references
  • Version 1.2: 2022-03-23
    Changes: Author supporting evidence, Data collection, Database references, Derived calculations
  • Version 1.3: 2024-05-22
    Changes: Data collection, Refinement description