4P0R | pdb_00004p0r

human Mus81-Eme1-3'flap DNA complex


Experimental Data Snapshot

  • Method: X-RAY DIFFRACTION
  • Resolution: 6.50 Å
  • R-Value Free: 
    0.295 (Depositor), 0.288 (DCC) 
  • R-Value Work: 
    0.210 (Depositor), 0.220 (DCC) 
  • R-Value Observed: 
    0.214 (Depositor) 

wwPDB Validation   3D Report Full Report


This is version 1.2 of the entry. See complete history


Literature

Crystal structures of the structure-selective nuclease Mus81-Eme1 bound to flap DNA substrates.

Gwon, G.H.Jo, A.Baek, K.Jin, K.S.Fu, Y.Lee, J.B.Kim, Y.Cho, Y.

(2014) EMBO J 33: 1061-1072

  • DOI: https://doi.org/10.1002/embj.201487820
  • Primary Citation Related Structures: 
    4P0P, 4P0Q, 4P0R, 4P0S

  • PubMed Abstract: 

    The Mus81-Eme1 complex is a structure-selective endonuclease with a critical role in the resolution of recombination intermediates during DNA repair after interstrand cross-links, replication fork collapse, or double-strand breaks. To explain the molecular basis of 3' flap substrate recognition and cleavage mechanism by Mus81-Eme1, we determined crystal structures of human Mus81-Eme1 bound to various flap DNA substrates. Mus81-Eme1 undergoes gross substrate-induced conformational changes that reveal two key features: (i) a hydrophobic wedge of Mus81 that separates pre- and post-nick duplex DNA and (ii) a "5' end binding pocket" that hosts the 5' nicked end of post-nick DNA. These features are crucial for comprehensive protein-DNA interaction, sharp bending of the 3' flap DNA substrate, and incision strand placement at the active site. While Mus81-Eme1 unexpectedly shares several common features with members of the 5' flap nuclease family, the combined structural, biochemical, and biophysical analyses explain why Mus81-Eme1 preferentially cleaves 3' flap DNA substrates with 5' nicked ends.


  • Organizational Affiliation
    • Department of Life Science, Pohang University of Science and Technology, Pohang, South Korea.

Macromolecules

Find similar proteins by:  (by identity cutoff)  |  3D Structure
Entity ID: 1
MoleculeChains Sequence LengthOrganismDetailsImage
Crossover junction endonuclease MUS81
A, C
306Homo sapiensMutation(s): 0 
Gene Names: MUS81
EC: 3.1.22
UniProt & NIH Common Fund Data Resources
Find proteins for Q96NY9 (Homo sapiens)
Explore Q96NY9 
Go to UniProtKB:  Q96NY9
PHAROS:  Q96NY9
GTEx:  ENSG00000172732 
Entity Groups  
Sequence Clusters30% Identity50% Identity70% Identity90% Identity95% Identity100% Identity
UniProt GroupQ96NY9
Sequence Annotations
Expand
  • Reference Sequence
Find similar proteins by:  (by identity cutoff)  |  3D Structure
Entity ID: 2
MoleculeChains Sequence LengthOrganismDetailsImage
Crossover junction endonuclease EME1
B, D
393Homo sapiensMutation(s): 0 
Gene Names: EME1MMS4
EC: 3.1.22
UniProt & NIH Common Fund Data Resources
Find proteins for Q96AY2 (Homo sapiens)
Explore Q96AY2 
Go to UniProtKB:  Q96AY2
PHAROS:  Q96AY2
GTEx:  ENSG00000154920 
Entity Groups  
Sequence Clusters30% Identity50% Identity70% Identity90% Identity95% Identity100% Identity
UniProt GroupQ96AY2
Sequence Annotations
Expand
  • Reference Sequence

Find similar nucleic acids by:  Sequence  

Entity ID: 3
MoleculeChains LengthOrganismImage
DNA CTGTGTGTAAGCACG
E, H
15synthetic construct
Sequence Annotations
Expand
  • Reference Sequence
Find similar nucleic acids by:  (by identity cutoff) 
Entity ID: 4
MoleculeChains LengthOrganismImage
DNA ACGTGCTTACACACAGAGGTTAGGGTGAACTT
F, I
32synthetic construct
Sequence Annotations
Expand
  • Reference Sequence

Find similar nucleic acids by:  Sequence  

Entity ID: 5
MoleculeChains LengthOrganismImage
DNA CAAGTTCACCCTAACCTCAG
G, J
20synthetic construct
Sequence Annotations
Expand
  • Reference Sequence
Experimental Data & Validation

Experimental Data

  • Method: X-RAY DIFFRACTION
  • Resolution: 6.50 Å
  • R-Value Free:  0.295 (Depositor), 0.288 (DCC) 
  • R-Value Work:  0.210 (Depositor), 0.220 (DCC) 
  • R-Value Observed: 0.214 (Depositor) 
Space Group: C 1 2 1
Unit Cell:
Length ( Å )Angle ( ˚ )
a = 221.757α = 90
b = 135.3β = 113.27
c = 102.889γ = 90
Software Package:
Software NamePurpose
PHENIXrefinement

Structure Validation

View Full Validation Report



Entry History 

Deposition Data

Revision History  (Full details and data files)

  • Version 1.0: 2014-05-28
    Type: Initial release
  • Version 1.1: 2015-01-14
    Changes: Database references
  • Version 1.2: 2023-12-27
    Changes: Data collection, Database references, Derived calculations, Other, Refinement description, Source and taxonomy