Skip to main content

 4P0S | pdb_00004p0s

human Mus81-Eme1-3'flap DNA complex


Experimental Data Snapshot

  • Method: X-RAY DIFFRACTION
  • Resolution: 6.00 Å
  • R-Value Free: 
    0.308 (Depositor), 0.328 (DCC) 
  • R-Value Work: 
    0.250 (Depositor), 0.276 (DCC) 
  • R-Value Observed: 
    0.253 (Depositor) 

wwPDB Validation 3D Report Full Report

Validation slider image for 4P0S

This is version 1.2 of the entry. See complete history. 

Literature

Crystal structures of the structure-selective nuclease Mus81-Eme1 bound to flap DNA substrates.

Gwon, G.H., Jo, A., Baek, K., Jin, K.S., Fu, Y., Lee, J.B., Kim, Y., Cho, Y.

(2014) EMBO J 33: 1061-1072

  • DOI: https://doi.org/10.1002/embj.201487820
  • Primary Citation Related Structures: 
    4P0P, 4P0Q, 4P0R, 4P0S

  • PubMed Abstract: 

    The Mus81-Eme1 complex is a structure-selective endonuclease with a critical role in the resolution of recombination intermediates during DNA repair after interstrand cross-links, replication fork collapse, or double-strand breaks. To explain the molecular basis of 3' flap substrate recognition and cleavage mechanism by Mus81-Eme1, we determined crystal structures of human Mus81-Eme1 bound to various flap DNA substrates. Mus81-Eme1 undergoes gross substrate-induced conformational changes that reveal two key features: (i) a hydrophobic wedge of Mus81 that separates pre- and post-nick duplex DNA and (ii) a "5' end binding pocket" that hosts the 5' nicked end of post-nick DNA. These features are crucial for comprehensive protein-DNA interaction, sharp bending of the 3' flap DNA substrate, and incision strand placement at the active site. While Mus81-Eme1 unexpectedly shares several common features with members of the 5' flap nuclease family, the combined structural, biochemical, and biophysical analyses explain why Mus81-Eme1 preferentially cleaves 3' flap DNA substrates with 5' nicked ends.


  • Organizational Affiliation: 
    • Department of Life Science, Pohang University of Science and Technology, Pohang, South Korea.

Macromolecule Content 

  • Total Structure Weight: 371.14 kDa 
  • Atom Count: 20,884 
  • Modeled Residue Count: 2,396 
  • Deposited Residue Count: 2,992 
  • Unique protein chains: 2
  • Unique nucleic acid chains: 3

Macromolecules


Find similar proteins by:|  3D Structure
Entity ID: 1
MoleculeChains  Sequence LengthOrganismDetailsImage
Crossover junction endonuclease MUS81
A, C, E, G
306Homo sapiensMutation(s): 0 
Gene Names: MUS81
EC: 3.1.22
UniProt & NIH Common Fund Data Resources
Find proteins for Q96NY9 (Homo sapiens)
Explore Q96NY9 
Go to UniProtKB:  Q96NY9
PHAROS:  Q96NY9
GTEx:  ENSG00000172732 
Entity Groups
Sequence Clusters30% Identity50% Identity70% Identity90% Identity95% Identity100% Identity
UniProt GroupQ96NY9
Sequence Annotations
Expand
Reference Sequence
Find similar proteins by:|  3D Structure
Entity ID: 2
MoleculeChains  Sequence LengthOrganismDetailsImage
Crossover junction endonuclease EME1
B, D, F, H
393Homo sapiensMutation(s): 0 
Gene Names: EME1, MMS4
EC: 3.1.22
UniProt & NIH Common Fund Data Resources
Find proteins for Q96AY2 (Homo sapiens)
Explore Q96AY2 
Go to UniProtKB:  Q96AY2
PHAROS:  Q96AY2
GTEx:  ENSG00000154920 
Entity Groups
Sequence Clusters30% Identity50% Identity70% Identity90% Identity95% Identity100% Identity
UniProt GroupQ96AY2
Sequence Annotations
Expand
Reference Sequence
Find similar nucleic acids by:  Sequence
Entity ID: 3
MoleculeChains LengthOrganismImage
DNA GAATGTGTGTCTI,
L [auth M],
O [auth Q],
R [auth U]
12synthetic construct
Sequence Annotations
Expand
Reference Sequence
Find similar nucleic acids by:  Sequence
Entity ID: 4
MoleculeChains LengthOrganismImage
DNA TAGACACACATTCGGGACATGCAGJ,
M [auth N],
P [auth R],
S [auth V]
24synthetic construct
Sequence Annotations
Expand
Reference Sequence
Find similar nucleic acids by:  Sequence
Entity ID: 5
MoleculeChains LengthOrganismImage
DNA TCTGCATGTCATTK [auth L],
N [auth P],
Q [auth T],
T [auth X]
13synthetic construct
Sequence Annotations
Expand
Reference Sequence

Experimental Data & Validation

Experimental Data

  • Method: X-RAY DIFFRACTION
  • Resolution: 6.00 Å
  • R-Value Free:  0.308 (Depositor), 0.328 (DCC) 
  • R-Value Work:  0.250 (Depositor), 0.276 (DCC) 
  • R-Value Observed: 0.253 (Depositor) 
Space Group: C 2 2 21
Unit Cell:
Length ( Å )Angle ( ˚ )
a = 92.442α = 90
b = 250.758β = 90
c = 430.24γ = 90
Software Package:
Software NamePurpose
PHENIXrefinement

Structure Validation

View Full Validation Report



Entry History 

Deposition Data

Revision History  (Full details and data files)

  • Version 1.0: 2014-05-28
    Type: Initial release
  • Version 1.1: 2015-01-14
    Changes: Database references
  • Version 1.2: 2023-12-27
    Changes: Data collection, Database references, Derived calculations, Other, Refinement description, Source and taxonomy