2M91 | pdb_00002m91

Structure of d[GGGAAGGGCGCGAAGCATTCGCGAGGTAGG] quadruplex-duplex hybrid

• PDB DOI: https://doi.org/10.2210/pdb2M91/pdb
• BMRB: 19279
• NAKB: 2M91

• Classification: DNA
• Mutation(s): No 


• Deposited: 2013-05-30 Released: 2013-07-10 
• Deposition Author(s): Lim, K.W., Phan, A.T.

---

Experimental Data Snapshot

• Method: SOLUTION NMR
• Conformers Calculated: 100 
• Conformers Submitted: 10 
• Selection Criteria: structures with the lowest energy 

Literature

Structural basis of DNA quadruplex-duplex junction formation.

Lim, K.W., Phan, A.T.

(2013) Angew Chem Int Ed Engl 52: 8566-8569

• PubMed: 23794476 
• DOI: https://doi.org/10.1002/anie.201302995
• Primary Citation of Related Structures:  
  2M8Y, 2M8Z, 2M90, 2M91, 2M92, 2M93

---

Organizational Affiliation: 

School of Physical and Mathematical Sciences, Nanyang Technological University, 21 Nanyang Link, Singapore 637371, Singapore.

Biological Assembly 1  

Biological assembly 1 assigned by authors.

Macromolecule Content

• Total Structure Weight: 9.44 kDa 
• Atom Count: 629 
• Modelled Residue Count: 30 
• Deposited Residue Count: 30 
• Unique nucleic acid chains: 1

Macromolecules

Entity ID: 1
Molecule	Chains	Length	Organism	Image
30-MER DNA	A	30	N/A

Experimental Data & Validation

Experimental Data

• Method: SOLUTION NMR
• Conformers Calculated: 100 
• Conformers Submitted: 10 
• Selection Criteria: structures with the lowest energy 

Structure Validation

Entry History 

Deposition Data

• Released Date: 2013-07-10 
Deposition Author(s): Lim, K.W., Phan, A.T.

Revision History  

• Version 1.0: 2013-07-10
  Type: Initial release
  
• Version 1.1: 2022-08-24
  Changes: Data collection, Database references
• Version 1.2: 2023-06-14
  Changes: Other
• Version 1.3: 2024-05-15
  Changes: Data collection, Database references