2M91

Structure of d[GGGAAGGGCGCGAAGCATTCGCGAGGTAGG] quadruplex-duplex hybrid

  • Classification: DNA
  • Mutation(s): No 

  • Deposited: 2013-05-30 Released: 2013-07-10 
  • Deposition Author(s): Lim, K.W., Phan, A.T.

Experimental Data Snapshot

  • Method: SOLUTION NMR
  • Conformers Calculated: 100 
  • Conformers Submitted: 10 
  • Selection Criteria: structures with the lowest energy 

wwPDB Validation   3D Report Full Report


This is version 1.2 of the entry. See complete history


Literature

Structural basis of DNA quadruplex-duplex junction formation.

Lim, K.W.Phan, A.T.

(2013) Angew Chem Int Ed Engl 52: 8566-8569


Macromolecules
Find similar nucleic acids by:  (by identity cutoff)  |  3D Structure
Entity ID: 1
MoleculeChains LengthOrganismImage
30-MER DNA30N/A
Sequence Annotations
Expand
  • Reference Sequence
Experimental Data & Validation

Experimental Data

  • Method: SOLUTION NMR
  • Conformers Calculated: 100 
  • Conformers Submitted: 10 
  • Selection Criteria: structures with the lowest energy 

Structure Validation

View Full Validation Report



Entry History 

Deposition Data

Revision History  (Full details and data files)

  • Version 1.0: 2013-07-10
    Type: Initial release
  • Version 1.1: 2022-08-24
    Changes: Data collection, Database references
  • Version 1.2: 2023-06-14
    Changes: Other