2M91 | pdb_00002m91

Structure of d[GGGAAGGGCGCGAAGCATTCGCGAGGTAGG] quadruplex-duplex hybrid

WebGL does not seem to be available.

This can be caused by an outdated browser, graphics card driver issue, or bad weather. Sometimes, just restarting the browser helps. Also, make sure hardware acceleration is enabled in your browser.

For a list of supported browsers, refer to http://caniuse.com/#feat=webgl.

Model 1 / 10
Welcome
RCSB PDB Mol* Viewer 2.11.4 [4/4/2025, 6:48:47 PM]
Sequence of
1    ​G​​G​​G​​A​​A​​G​​G​​G​​C​​G​11   ​C​​G​​A​​A​​G​​C​​A​​T​​T​​C​21   ​G​​C​​G​​A​​G​​G​​T​​A​​G​​G​
Model Index
Type
Asm Id
Dynamic Bonds

Select a different viewer