Skip to main content

 1OLD | pdb_00001old

NMR STRUCTURE OF 24-MER DEOXYRIBONUCLEIC ACID, 7 STRUCTURES

  • Classification: DNA
  • Mutation(s): No 

  • Deposited: 1996-10-31 Released: 1997-04-21 
  • Deposition Author(s): Lin, C.H., Patel, D.J.

Experimental Data Snapshot

  • Method: SOLUTION NMR
  • Conformers Submitted: 7 

wwPDB Validation 3D Report Full Report

Validation slider image for 1OLD

This is version 2.1 of the entry. See complete history. 

Literature

Encapsulating an amino acid in a DNA fold.

Lin, C.H., Patel, D.J.

(1996) Nat Struct Biol 3: 1046-1050

  • DOI: https://doi.org/10.1038/nsb1296-1046
  • Primary Citation Related Structures: 
    1OLD

  • PubMed Abstract: 

    Here we present the first solution structure of a ligand-DNA aptamer complex. Our NMR-molecular dynamics structural studies of the interaction between argininamide and a DNA stem-loop complex establishes that the hairpin loop DNA binding site undergoes an adaptive conformational transition on complex formation. The tip of the DNA loop folds down towards the stem and sandwiches the bound argininamide between reversed Hoogsteen A.C and Watson-Crick G.C base pairs. The argininamide is encapsulated within the structured DNA loop and is stabilized by an intricate set of intermolecular hydrogen bonds and stacking interactions. The structure of the complex lays out the molecular principles defining both the architecture of the internal cavity and the recognition elements that could contribute to ligand discrimination.


  • Organizational Affiliation: 
    • Cellular Biochemistry & Biophysics Program, Memorial Sloan-Kettering Cancer Center New York, New York 10021, USA.

Macromolecule Content 

  • Total Structure Weight: 7.53 kDa 
  • Atom Count: 500 
  • Modeled Residue Count: 24 
  • Deposited Residue Count: 24 
  • Unique nucleic acid chains: 1

Macromolecules

Find similar nucleic acids by:  Sequence
Entity ID: 1
MoleculeChains LengthOrganismImage
DNA (GATCGAAACGTAGCGCCTTCGATC)24N/A
Sequence Annotations
Expand
Reference Sequence

Small Molecules

Ligands 1 Unique
IDChains Name / Formula / InChI Key2D Diagram3D Interactions
AAR

Query on AAR



Download:Ideal Coordinates CCD File
B [auth A]ARGININEAMIDE
C6 H16 N5 O
ULEBESPCVWBNIF-BYPYZUCNSA-O

Experimental Data & Validation

Experimental Data

  • Method: SOLUTION NMR
  • Conformers Submitted: 7 

Structure Validation

View Full Validation Report



Entry History 

Deposition Data

Revision History  (Full details and data files)

  • Version 1.0: 1997-04-21
    Type: Initial release
  • Version 1.1: 2008-03-24
    Changes: Version format compliance
  • Version 1.2: 2011-07-13
    Changes: Version format compliance
  • Version 1.3: 2022-02-23
    Changes: Database references, Derived calculations, Other
  • Version 2.0: 2022-07-06
    Changes: Atomic model, Data collection, Database references, Derived calculations, Non-polymer description, Source and taxonomy, Structure summary
  • Version 2.1: 2024-05-22
    Changes: Data collection