5J05

DIY G-Quadruplexes: Solution structure of d(GGGTTTGGGTTTTGGGAGGG) in sodium


Experimental Data Snapshot

  • Method: SOLUTION NMR
  • Conformers Calculated: 100 
  • Conformers Submitted: 10 
  • Selection Criteria: structures with the lowest energy 

wwPDB Validation   3D Report Full Report


This is version 1.4 of the entry. See complete history


Literature

Encoding canonical DNA quadruplex structure.

Dvorkin, S.A.Karsisiotis, A.I.Webba da Silva, M.

(2018) Sci Adv 4: eaat3007-eaat3007

  • DOI: https://doi.org/10.1126/sciadv.aat3007
  • Primary Citation of Related Structures:  
    2M6V, 2M6W, 5J05, 5J4P, 5J4W, 5J6U

  • PubMed Abstract: 

    The main challenge in DNA quadruplex design is to encode a three-dimensional structure into the primary sequence, despite its multiple, repetitive guanine segments. We identify and detail structural elements describing all 14 feasible canonical quadruplex scaffolds and demonstrate their use in control of design. This work outlines a new roadmap for implementation of targeted design of quadruplexes for material, biotechnological, and therapeutic applications.


  • Organizational Affiliation

    School of Pharmacy and Pharmaceutical Sciences, Biomedical Sciences Research Institute, Ulster University, Coleraine BT52 1SA, UK.


Macromolecules

Find similar nucleic acids by:  Sequence   |   3D Structure  

Entity ID: 1
MoleculeChains LengthOrganismImage
DNA (5'-D(*GP*GP*GP*TP*TP*TP*GP*GP*GP*TP*TP*TP*TP*GP*GP*GP*AP*GP*GP*G)-3')20synthetic construct
Sequence Annotations
Expand
  • Reference Sequence
Experimental Data & Validation

Experimental Data

  • Method: SOLUTION NMR
  • Conformers Calculated: 100 
  • Conformers Submitted: 10 
  • Selection Criteria: structures with the lowest energy 

Structure Validation

View Full Validation Report



Entry History 

Deposition Data

Revision History  (Full details and data files)

  • Version 1.0: 2017-04-05
    Type: Initial release
  • Version 1.1: 2018-10-10
    Changes: Data collection, Database references
  • Version 1.2: 2019-05-08
    Changes: Data collection
  • Version 1.3: 2019-10-23
    Changes: Data collection, Derived calculations, Experimental preparation
  • Version 1.4: 2024-05-15
    Changes: Data collection, Database references