☰ Navigation Tabs
DIY G-Quadruplexes: Solution structure of d(GGGTTTGGGTTTTGGGAGGG) in sodium
NMR Experiment Experiment Type Sample Contents Solvent Ionic Strength pH Pressure Temperature (K) Spectrometer 1 H,H jr-NOESY 1 mM DNA 93% H2O/7% D2O 20 mM NaPi mM 6.8 1 atm 293.15 Varian VNMRS 500 2 2D 1H-1H NOESY 1 mM DNA 100% D2O 20 mM NaPi mM 6.8 1 atm 293.15 Varian VNMRS 500
NMR Spectrometer Information Spectrometer Manufacturer Model Field Strength 1 Varian VNMRS 500
NMR Refinement Method Details Software molecular dynamics Xplor-NIH
NMR Ensemble Information Conformer Selection Criteria structures with the lowest energy Conformers Calculated Total Number 100 Conformers Submitted Total Number 10 Representative Model 1 (lowest energy)
Computation: NMR Software # Classification Version Software Name Author 1 refinement Felix Accelrys Software Inc. 2 structure calculation Xplor-NIH Schwieters, Kuszewski, Tjandra and Clore 3 chemical shift assignment Felix Accelrys Software Inc.