DIY G-Quadruplexes: Solution structure of d(GGGTTTGGGTTTTGGGAGGG) in sodium
SOLUTION NMR
| NMR Experiment | ||||||||
|---|---|---|---|---|---|---|---|---|
| Experiment | Type | Sample Contents | Solvent | Ionic Strength | pH | Pressure | Temperature (K) | Spectrometer |
| 1 | H,H jr-NOESY | 1 mM DNA | 93% H2O/7% D2O | 20 mM NaPi mM | 6.8 | 1 atm | 293.15 | Varian VNMRS 500 |
| 2 | 2D 1H-1H NOESY | 1 mM DNA | 100% D2O | 20 mM NaPi mM | 6.8 | 1 atm | 293.15 | Varian VNMRS 500 |
| NMR Spectrometer Information | |||
|---|---|---|---|
| Spectrometer | Manufacturer | Model | Field Strength |
| 1 | Varian | VNMRS | 500 |
| NMR Refinement | ||
|---|---|---|
| Method | Details | Software |
| molecular dynamics | Xplor-NIH | |
| NMR Ensemble Information | |
|---|---|
| Conformer Selection Criteria | structures with the lowest energy |
| Conformers Calculated Total Number | 100 |
| Conformers Submitted Total Number | 10 |
| Representative Model | 1 (lowest energy) |
| Computation: NMR Software | ||||
|---|---|---|---|---|
| # | Classification | Version | Software Name | Author |
| 1 | refinement | Felix | Accelrys Software Inc. | |
| 2 | structure calculation | Xplor-NIH | Schwieters, Kuszewski, Tjandra and Clore | |
| 3 | chemical shift assignment | Felix | Accelrys Software Inc. | |














