Crystal structure of Fis bound to 27bp DNA F1-8G (AAATTGGTTTGAATTTTGAGCCAATTT)
Domain Annotation: ECOD Classification ECOD Database Homepage
| Chains | Family Name | Domain Identifier | Architecture | Possible Homology | Homology | Topology | Family | Provenance Source (Version) |
|---|---|---|---|---|---|---|---|---|
| B | Hema_esterase | e5e3lB1 | A: a/b three-layered sandwiches | X: CXXC domain-like | H: CXXC domain | T: CXXC domain | F: Hema_esterase | ECOD (v294.1) |
| A | Hema_esterase | e5e3lA1 | A: a/b three-layered sandwiches | X: CXXC domain-like | H: CXXC domain | T: CXXC domain | F: Hema_esterase | ECOD (v294.1) |
Domain Annotation: CATH CATH Database Homepage
| Chain | Domain | Class | Architecture | Topology | Homology | Provenance Source (Version) |
|---|---|---|---|---|---|---|
| B | 1.10.10.60 | Mainly Alpha | Orthogonal Bundle | Arc Repressor Mutant, subunit A | Homeodomain-like | CATH (4.3.0) |
| A | 1.10.10.60 | Mainly Alpha | Orthogonal Bundle | Arc Repressor Mutant, subunit A | Homeodomain-like | CATH (4.3.0) |
Protein Family Annotation Pfam Database Homepage
| Chains | Accession | Name | Description | Comments | Source |
|---|---|---|---|---|---|
| PF02954 | Bacterial regulatory protein, Fis family (HTH_8) | Bacterial regulatory protein, Fis family | Domain |
Gene Ontology: Gene Product Annotation Gene Ontology Database Homepage
InterPro: Protein Family Classification InterPro Database Homepage
| Chains | Accession | Name | Type |
|---|---|---|---|
| IPR009057 | Homedomain-like superfamily | Homologous Superfamily | |
| IPR002197 | DNA binding HTH domain, Fis-type | Domain | |
| IPR050207 | Trans_regulatory_Fis | Unknown | |
| IPR005412 | DNA-binding protein Fis | Family |














