1G9Z
LAGLIDADG HOMING ENDONUCLEASE I-CREI / DNA PRODUCT COMPLEX WITH MAGNESIUM
External Resource: Annotation
Domain Annotation: SCOP/SCOPe Classification SCOP-e Database Homepage
Chains | Domain Info | Class | Fold | Superfamily | Family | Domain | Species | Provenance Source (Version) |
---|---|---|---|---|---|---|---|---|
E [auth A] | d1g9za_ | Alpha and beta proteins (a+b) | Homing endonuclease-like | Homing endonucleases | Group I mobile intron endonuclease | DNA endonuclease I-CreI | (Chlamydomonas reinhardtii ) [TaxId: 3055 ], | SCOPe (2.08) |
F [auth B] | d1g9zb_ | Alpha and beta proteins (a+b) | Homing endonuclease-like | Homing endonucleases | Group I mobile intron endonuclease | DNA endonuclease I-CreI | (Chlamydomonas reinhardtii ) [TaxId: 3055 ], | SCOPe (2.08) |
Domain Annotation: SCOP2 Classification SCOP2 Database Homepage
Chains | Type | Family Name | Domain Identifier | Family Identifier | Provenance Source (Version) |
---|---|---|---|---|---|
E [auth A] | SCOP2 Family | Group I mobile intron endonuclease | 8020329 | 4001698 | SCOP2 (2022-06-29) |
E [auth A] | SCOP2 Superfamily | Homing endonucleases | 8032709 | 3000266 | SCOP2 (2022-06-29) |
F [auth B] | SCOP2B Superfamily | Homing endonucleases | 8032709 | 3000266 | SCOP2B (2022-06-29) |
Domain Annotation: ECOD Classification ECOD Database Homepage
Chains | Family Name | Domain Identifier | Architecture | Possible Homology | Homology | Topology | Family | Provenance Source (Version) |
---|---|---|---|---|---|---|---|---|
E [auth A] | PF00961 | e1g9zA1 | A: a+b two layers | X: Homing endonucleases-like | H: Homing endonucleases (From Topology) | T: Homing endonucleases | F: PF00961 | ECOD (1.6) |
F [auth B] | PF00961 | e1g9zB1 | A: a+b two layers | X: Homing endonucleases-like | H: Homing endonucleases (From Topology) | T: Homing endonucleases | F: PF00961 | ECOD (1.6) |
Domain Annotation: CATH CATH Database Homepage
Chain | Domain | Class | Architecture | Topology | Homology | Provenance Source (Version) |
---|---|---|---|---|---|---|
E [auth A] | 3.10.28.10 | Alpha Beta | Roll | Endonuclease I-creI | Homing endonucleases | CATH (4.3.0) |
F [auth B] | 3.10.28.10 | Alpha Beta | Roll | Endonuclease I-creI | Homing endonucleases | CATH (4.3.0) |
Protein Family Annotation Pfam Database Homepage
Chains | Accession | Name | Description | Comments | Source |
---|---|---|---|---|---|
E [auth A], F [auth B] | PF00961 | LAGLIDADG endonuclease (LAGLIDADG_1) | LAGLIDADG endonuclease | - | Domain |
Gene Ontology: Gene Product Annotation Gene Ontology Database Homepage
Chains | Polymer | Molecular Function | Biological Process | Cellular Component |
---|---|---|---|---|
A [auth C] | 5'-D(*GP*CP*AP*AP*AP*AP*CP*GP*TP*CP*GP*TP*GP*A)-3' | - | - | - |
B [auth D] | 5'-D(P*GP*AP*CP*AP*GP*TP*TP*TP*CP*G)-3' | - | - | - |
C [auth E] | 5'-D(*CP*GP*AP*AP*AP*CP*TP*GP*TP*CP*TP*CP*AP*C)-3' | - | - | - |
D [auth F] | 5'-D(P*GP*AP*CP*GP*TP*TP*TP*TP*GP*C)-3' | - | - | - |
E [auth A], F [auth B] | DNA ENDONUCLEASE I-CREI |
InterPro: Protein Family Classification InterPro Database Homepage
Chains | Accession | Name | Type |
---|---|---|---|
E [auth A], F [auth B] | IPR004860 | Homing endonuclease, LAGLIDADG domain | Domain |
E [auth A], F [auth B] | IPR027434 | Homing endonuclease | Homologous Superfamily |
Structure Motif Annotation: Mechanism and Catalytic Site Atlas M-CSA Database Homepage
Chains | Enzyme Name | Description | Catalytic Residues |
---|---|---|---|
DNA endonuclease I-CreI M-CSA #233 | This is an endonuclease that is involved in group I intron homing. It recognises and cleavers a 19-24 bp palindromic DNA site. It is known to bind three Mg(II) ions per homodimer, it is also active with Mn(II), gives lower cleavage activity with Ni(II) and Zn(II) and no activity with Ca(II). I-CreI exists as a homodimer and the active sites of the enzyme overlap. Mg1 binds to one subunit, Mg3 binds to the other and Mg2 is bound to both. Mg2 is involved in the hydrolysis of both strands of DNA while Mg1 is involved in the hydrolysis of one strand and Mg3 the other. Homing endonucleases do not have stringently-defined recognition sequences in the way that other restriction enzymes do. That is, single base changes do not abolish cleavage but reduce its efficiency to variable extents. The precise boundary of required bases is generally not known. The recognition sequence of one site known to be recognised and cleaved is CTGGGTTCAAAACGTCGTGAGACAGTTTGG (-10/-14). | Defined by 3 residues: GLY:E-18 [auth A-19]ASP:E-19 [auth A-20]ASP:F-19 [auth B-220] | EC: 3.1 (PDB Primary Data) |