1G9Z | pdb_00001g9z

LAGLIDADG HOMING ENDONUCLEASE I-CREI / DNA PRODUCT COMPLEX WITH MAGNESIUM


Domain Annotation: SCOP2 Classification SCOP2 Database Homepage

ChainsTypeFamily Name Domain Identifier Family IdentifierProvenance Source (Version)
F [auth B]SCOP2B SuperfamilyHoming endonucleases 8032709 3000266 SCOP2B (2022-06-29)
E [auth A]SCOP2 FamilyGroup I mobile intron endonuclease 8020329 4001698 SCOP2 (2022-06-29)
E [auth A]SCOP2 SuperfamilyHoming endonucleases 8032709 3000266 SCOP2 (2022-06-29)

Domain Annotation: ECOD Classification ECOD Database Homepage

ChainsFamily NameDomain Identifier ArchitecturePossible HomologyHomologyTopologyFamilyProvenance Source (Version)
F [auth B]tRNA_int_endo_Ne1g9zB1 A: alpha arraysX: ETN0001 domain-likeH: General secretion pathway protein M (EpsM) periplasmic domain-relatedT: General secretion pathway protein M (EpsM) periplasmic domain-relatedF: tRNA_int_endo_NECOD (v295)
E [auth A]tRNA_int_endo_Ne1g9zA1 A: alpha arraysX: ETN0001 domain-likeH: General secretion pathway protein M (EpsM) periplasmic domain-relatedT: General secretion pathway protein M (EpsM) periplasmic domain-relatedF: tRNA_int_endo_NECOD (v295)

Domain Annotation: CATH CATH Database Homepage

ChainDomainClassArchitectureTopologyHomologyProvenance Source (Version)
F [auth B]3.10.28.10 Alpha Beta Roll Endonuclease I-creI Homing endonucleasesCATH (4.3.0)
E [auth A]3.10.28.10 Alpha Beta Roll Endonuclease I-creI Homing endonucleasesCATH (4.3.0)

InterPro: Protein Family Classification InterPro Database Homepage

Structure Motif Annotation: Mechanism and Catalytic Site Atlas M-CSA Database Homepage

ChainsEnzyme NameDescriptionCatalytic Residues
DNA endonuclease I-CreI  M-CSA #233

This is an endonuclease that is involved in group I intron homing. It recognises and cleavers a 19-24 bp palindromic DNA site. It is known to bind three Mg(II) ions per homodimer, it is also active with Mn(II), gives lower cleavage activity with Ni(II) and Zn(II) and no activity with Ca(II). I-CreI exists as a homodimer and the active sites of the enzyme overlap. Mg1 binds to one subunit, Mg3 binds to the other and Mg2 is bound to both. Mg2 is involved in the hydrolysis of both strands of DNA while Mg1 is involved in the hydrolysis of one strand and Mg3 the other.

Homing endonucleases do not have stringently-defined recognition sequences in the way that other restriction enzymes do. That is, single base changes do not abolish cleavage but reduce its efficiency to variable extents. The precise boundary of required bases is generally not known. The recognition sequence of one site known to be recognised and cleaved is CTGGGTTCAAAACGTCGTGAGACAGTTTGG (-10/-14).

Defined by 3 residues: GLY:E-18 [auth A-19]ASP:E-19 [auth A-20]ASP:F-19 [auth B-220]
 | 
 
Explore in 3DM-CSA Motif Definition
EC: 3.1 (PDB Primary Data)