9RJS | pdb_00009rjs

Structure of the Bacteriophage PhiKZ non-virion RNA Polymerase bound to an analogue of its promoter


Experimental Data Snapshot

  • Method: ELECTRON MICROSCOPY
  • Resolution: 2.59 Å
  • Aggregation State: PARTICLE 
  • Reconstruction Method: SINGLE PARTICLE 

Starting Models: in silico, experimental
View more details

wwPDB Validation   3D Report Full Report


This is version 1.1 of the entry. See complete history


Literature

Structure of the bacteriophage PhiKZ non-virion RNA polymerase bound to a p119L open promoter analogue.

Chen, C.S.de Martin Garrido, N.Yakunina, M.Aylett, C.H.S.

(2026) IUCrJ 13: 31-43

  • DOI: https://doi.org/10.1107/S2052252525009273
  • Primary Citation Related Structures: 
    9RJS

  • PubMed Abstract: 

    Bacteriophage ΦKZ (PhiKZ) was the first identified member of a family of massive bacterial viruses. ΦKZ infects Pseudomonas aeruginosa, which kills tens of thousands every year, and it therefore has potential as a bacteriophage therapy. On infection, ΦKZ forms a `nucleus' to protect its genome by excluding host immune systems. This barrier means that it has had to become independent of the host transcriptional apparatus; it cannot simply recruit the host RNA polymerase (RNAP) to its promoters as it is excluded from the viral DNA, and therefore it expresses and imports its own non-virion RNA polymerase (nvRNAP). The ΦKZ nvRNAP, and related jumbo-phage RNAPs including that from bacteriophage AR9, are particularly noteworthy. Unlike typical viral RNAPs which are formed as only a single subunit, it is a non-canonical multi-subunit RNAP directly related to those from eubacteria, and more distantly eukaryotes and archaea. It encompasses four proteins representing patchwork homologues of the eubacterial β/β' subunits, and a fifth that appears to have evolved from a σ factor, but no homologues of the α or ω subunits required for formation of a catalytically active complex in eubacterial RNAPs. Its mechanism of promoter recognition is also highly divergent; transcription is initiated from a site marked only by a tiny four-base consensus sequence co-located with the start site. We have resolved the structure of the ΦKZ nvRNAP bound to an open analogue of its cognate promoter, p119L, revealing that while the σ-factor-like subunit GP68 is involved in bubble stabilization, the sequence-specific promoter consensus sequence is bound between the lobe of the β-subunit homologue GP123 and the enzymatic core of the complex. Our results shed light on the differences between mechanisms of promoter recognition in the ΦKZ nvRNAP and canonical eubacterial RNAPs, and on the uniquely specialized features of bacteriophage transcriptional apparatuses in general.


  • Organizational Affiliation
    • Section for Structural and Synthetic Biology, Department of Infectious Disease, Imperial College London, London, United Kingdom.

Macromolecules

Find similar proteins by:  (by identity cutoff)  |  3D Structure
Entity ID: 1
MoleculeChains Sequence LengthOrganismDetailsImage
DNA-directed RNA polymerase,PHIKZ056.1508Phikzvirus phiKZMutation(s): 0 
UniProt
Find proteins for I7DB47 (Pseudomonas phage PA7)
Explore I7DB47 
Go to UniProtKB:  I7DB47
Find proteins for L7T138 (Pseudomonas phage phiKZ)
Explore L7T138 
Go to UniProtKB:  L7T138
Entity Groups  
Sequence Clusters30% Identity50% Identity70% Identity90% Identity95% Identity100% Identity
UniProt GroupsI7DB47L7T138
Sequence Annotations
Expand
  • Reference Sequence
Find similar proteins by:  (by identity cutoff)  |  3D Structure
Entity ID: 2
MoleculeChains Sequence LengthOrganismDetailsImage
PHIKZ068521Phikzvirus phiKZMutation(s): 0 
UniProt
Find proteins for Q8SD94 (Pseudomonas phage phiKZ)
Explore Q8SD94 
Go to UniProtKB:  Q8SD94
Entity Groups  
Sequence Clusters30% Identity50% Identity70% Identity90% Identity95% Identity100% Identity
UniProt GroupQ8SD94
Sequence Annotations
Expand
  • Reference Sequence
Find similar proteins by:  (by identity cutoff)  |  3D Structure
Entity ID: 3
MoleculeChains Sequence LengthOrganismDetailsImage
PHIKZ071700Phikzvirus phiKZMutation(s): 0 
EC: 2.7.7.6
UniProt
Find proteins for I7DB36 (Pseudomonas phage PA7)
Explore I7DB36 
Go to UniProtKB:  I7DB36
Entity Groups  
Sequence Clusters30% Identity50% Identity70% Identity90% Identity95% Identity100% Identity
UniProt GroupI7DB36
Sequence Annotations
Expand
  • Reference Sequence
Find similar proteins by:  (by identity cutoff)  |  3D Structure
Entity ID: 4
MoleculeChains Sequence LengthOrganismDetailsImage
PHIKZ074677Phikzvirus phiKZMutation(s): 0 
UniProt
Find proteins for Q8SD88 (Pseudomonas phage phiKZ)
Explore Q8SD88 
Go to UniProtKB:  Q8SD88
Entity Groups  
Sequence Clusters30% Identity50% Identity70% Identity90% Identity95% Identity100% Identity
UniProt GroupQ8SD88
Sequence Annotations
Expand
  • Reference Sequence
Find similar proteins by:  (by identity cutoff)  |  3D Structure
Entity ID: 5
MoleculeChains Sequence LengthOrganismDetailsImage
PHIKZ123543Phikzvirus phiKZMutation(s): 0 
UniProt
Find proteins for Q8SD39 (Pseudomonas phage phiKZ)
Explore Q8SD39 
Go to UniProtKB:  Q8SD39
Entity Groups  
Sequence Clusters30% Identity50% Identity70% Identity90% Identity95% Identity100% Identity
UniProt GroupQ8SD39
Sequence Annotations
Expand
  • Reference Sequence
Find similar nucleic acids by:  (by identity cutoff) 
Entity ID: 6
MoleculeChains LengthOrganismImage
DNA - ATGAGTAATTTTAGTGAATGTATTTGCTATATTGCTATGTAGACAGTTCCCAAAAGCCTAAAGTTACAATATAGGF [auth X]75Phikzvirus phiKZ
Sequence Annotations
Expand
  • Reference Sequence
Find similar nucleic acids by:  (by identity cutoff) 
Entity ID: 7
MoleculeChains LengthOrganismImage
DNA - CCTATATTGTAACTTTAGGCTTTTGGGAACTCCTCTCATATTCCCATAGCAAATACATTCACTAAAATTACTCATG [auth Y]75Phikzvirus phiKZ
Sequence Annotations
Expand
  • Reference Sequence
Experimental Data & Validation

Experimental Data

  • Method: ELECTRON MICROSCOPY
  • Resolution: 2.59 Å
  • Aggregation State: PARTICLE 
  • Reconstruction Method: SINGLE PARTICLE 
EM Software:
TaskSoftware PackageVersion
RECONSTRUCTIONRELION4
MODEL REFINEMENTPHENIX

Structure Validation

View Full Validation Report



Entry History & Funding Information

Deposition Data


Funding OrganizationLocationGrant Number
Wellcome TrustUnited Kingdom206212/Z/17/A
Royal SocietyUnited Kingdom206212/Z/17/A

Revision History  (Full details and data files)

  • Version 1.0: 2025-07-16
    Type: Initial release
  • Version 1.1: 2026-04-01
    Changes: Data collection, Database references