2M93 | pdb_00002m93

Structure of d[TTGGGTGGGCGCGAAGCATTCGCGGGGTGGGT] quadruplex-duplex hybrid

  • Classification: DNA
  • Mutation(s): No 

  • Deposited: 2013-05-30 Released: 2013-07-10 
  • Deposition Author(s): Lim, K.W., Phan, A.T.

Experimental Data Snapshot

  • Method: SOLUTION NMR
  • Conformers Calculated: 100 
  • Conformers Submitted: 10 
  • Selection Criteria: structures with the lowest energy 

wwPDB Validation 3D Report Full Report

Validation slider image for 2M93

This is version 1.3 of the entry. See complete history

Literature

Structural basis of DNA quadruplex-duplex junction formation.

Lim, K.W.Phan, A.T.

(2013) Angew Chem Int Ed Engl 52: 8566-8569

Macromolecule Content 

  • Total Structure Weight: 10.07 kDa 
  • Atom Count: 669 
  • Modeled Residue Count: 32 
  • Deposited Residue Count: 32 
  • Unique nucleic acid chains: 1

Macromolecules

Find similar nucleic acids by:  (by identity cutoff) 
Entity ID: 1
MoleculeChains LengthOrganismImage
32-MER DNA32N/A
Sequence Annotations
Expand
Reference Sequence

Experimental Data & Validation

Experimental Data

  • Method: SOLUTION NMR
  • Conformers Calculated: 100 
  • Conformers Submitted: 10 
  • Selection Criteria: structures with the lowest energy 

Structure Validation

View Full Validation Report



Entry History 

Deposition Data

Revision History  (Full details and data files)

  • Version 1.0: 2013-07-10
    Type: Initial release
  • Version 1.1: 2022-08-24
    Changes: Data collection, Database references
  • Version 1.2: 2023-06-14
    Changes: Other
  • Version 1.3: 2024-05-15
    Changes: Data collection, Database references