1FG0 | pdb_00001fg0

LARGE RIBOSOMAL SUBUNIT COMPLEXED WITH A 13 BP MINIHELIX-PUROMYCIN COMPOUND


Experimental Data Snapshot

  • Method: X-RAY DIFFRACTION
  • Resolution: 3.00 Å
  • R-Value Work: 
    0.522 (DCC) 

wwPDB Validation 3D Report Full Report

Validation slider image for 1FG0

This is version 1.3 of the entry. See complete history

Literature

The structural basis of ribosome activity in peptide bond synthesis.

Nissen, P.Hansen, J.Ban, N.Moore, P.B.Steitz, T.A.

(2000) Science 289: 920-930

  • DOI: https://doi.org/10.1126/science.289.5481.920
  • Primary Citation Related Structures: 
    1FFZ, 1FG0

  • PubMed Abstract: 

    Using the atomic structures of the large ribosomal subunit from Haloarcula marismortui and its complexes with two substrate analogs, we establish that the ribosome is a ribozyme and address the catalytic properties of its all-RNA active site. Both substrate analogs are contacted exclusively by conserved ribosomal RNA (rRNA) residues from domain V of 23S rRNA; there are no protein side-chain atoms closer than about 18 angstroms to the peptide bond being synthesized. The mechanism of peptide bond synthesis appears to resemble the reverse of the acylation step in serine proteases, with the base of A2486 (A2451 in Escherichia coli) playing the same general base role as histidine-57 in chymotrypsin. The unusual pK(a) (where K(a) is the acid dissociation constant) required for A2486 to perform this function may derive in part from its hydrogen bonding to G2482 (G2447 in E. coli), which also interacts with a buried phosphate that could stabilize unusual tautomers of these two bases. The polypeptide exit tunnel is largely formed by RNA but has significant contributions from proteins L4, L22, and L39e, and its exit is encircled by proteins L19, L22, L23, L24, L29, and L31e.


  • Organizational Affiliation
    • Department of Molecular Biophysics and Biochemistry and Department of Chemistry, Yale University, and Howard Hughes Medical Institute, New Haven, CT 06520-8114, USA.

Macromolecule Content 

  • Total Structure Weight: 205.99 kDa 
  • Atom Count: 10,704 
  • Modeled Residue Count: 499 
  • Deposited Residue Count: 636 
  • Unique nucleic acid chains: 2

Macromolecules

Find similar nucleic acids by:  (by identity cutoff) 
Entity ID: 1
MoleculeChains LengthOrganismImage
23S RIBOSOMAL RNA602Haloarcula marismortui
Sequence Annotations
Expand
Reference Sequence
Find similar nucleic acids by:  (by identity cutoff) 
Entity ID: 2
MoleculeChains LengthOrganismImage
5'-R(CCGGCGGGCUGGUUCAAACCGGCCCGCCGGACC)-3'-5'-R(P-PUROMYCIN)-3'34N/A
Sequence Annotations
Expand
Reference Sequence

Experimental Data & Validation

Experimental Data

  • Method: X-RAY DIFFRACTION
  • Resolution: 3.00 Å
  • R-Value Work:  0.522 (DCC) 
Space Group: C 2 2 21
Unit Cell:
Length ( Å )Angle ( ˚ )
a = 212α = 90
b = 300β = 90
c = 574γ = 90
Software Package:
Software NamePurpose
DENZOdata reduction
SCALEPACKdata scaling
CNSrefinement
Omodel building
CNSphasing

Structure Validation

View Full Validation Report



Entry History 

Deposition Data

Revision History  (Full details and data files)

  • Version 1.0: 2000-08-28
    Type: Initial release
  • Version 1.1: 2008-04-27
    Changes: Version format compliance
  • Version 1.2: 2011-07-13
    Changes: Version format compliance
  • Version 1.3: 2024-02-07
    Changes: Data collection, Database references