1QWB
NMR structure of 5'-r(GGACACGAAAUCCCGAAGUAGUGUCC)-3' : an RNA hairpin containing the in vitro selected consensus sequence for nucleolin RBD12
NOTE: Use your mouse to access Jsmol features and to drag, rotate, and zoom in and out of the structure.Help
Scripting Options
Structure Details
Select Options
Surface options may take a long time to render, especially for larger structures
Select a different viewer
Help Links
Jmol, an open source Java viewer for chemical structures in 3D (http://www.jmol.org)